Wikia

MyBio

Sequence format conversion

Talk0
806pages on
this wiki

GGATCCAGCTCCGACGCAGCCGGCTGGCGAAGCGGCTGTCGAAGCCCGCCAGTTGTTTTCAGACACCGCAAACGACCTGGAAAACGGGGTGTCCAGCAACTGCCCCAAAGTCATCTTCATCTGCGCCCGCGGCTCCACCGAGACCGGCAACTTGGGCTCATCCGTCTGCCCCGAGGTAGCCAACGGCCTCAAGAACTACTACCCCAACCAACTCTGGGTGCAGGGCGTCGGGGGCGCCTACACGGCCGACCTGGCCTCCAACGCGCTTCCCGGGGGCACCTCGACGGCGGCGATGCAGGAGGCGGCCAACATGTTCAACCTGGCGCAGCAGAAGTGCCCGAACGCGTCGGTCGCCGCGGGCGGGTACAGCCAGGGCACGGCCGTCGTCGCCGGCGGCATCCAGTCGCTGTCGGCGGCGGCCAAGGACCAGATCAAGGGCGTCGTGCTCTTCGGCTACACGCAGGCGCAGCAGAACCACGACACCATCCCGGATTTCCCCGTCGACAAGACCATGATCTTCTGCGCCCAGGGCGACCTCGTCTGCAACGGCACCCTGATCGTCACCGCGGCCCACTTCTCCTACATCACCAACGGCGACGCGTCCACCAAGGGCCCGGCCTGGCTGCACGAGAAGATTGGCGATGCTTGAAAGCTTEdit

Around Wikia's network

Random Wiki