Wikia

MyBio

Sequence format conversion

Talk0
804pages on
this wiki

Edit

TATTC TGGGCTCCTG GAACCAATCC CGTGAAAGAA

 

251 TTATTTTTGT GTTTCTAAAA CTATGGTTCC CAATAAAAGT GACTCTCAGY

 

301 RAGCCTCAAT GCTCCCAGTG CTATTCATGG GCAGCTCTCT GGGCTCAGGA

 

351 AGAGCCAGTA ATACTACTGG ATAAAGAAGA CTTAAGAATC CRCCACCTGG

 

401 TGCACGCTGG TAGTCCGAGC ACTCGGGAGG CTGAGGTGGG AGGATCGCTT

AGCGAAAGCAGGCAAACCATTTGAATGGATGTCAATCCGACTCTACTTTTCCTAAAAATT CCAGCGCAAAATGCCATAAGCACCACATTCCCTTATACTGGAGATCCTCCATACAGCCAT GGAACAGGAACAGGATACACCATGGACACAGTAAACAGAACACACCAATACTCAGAAAA GGGAAAGTGGACGACAAACACAGAGACTGGTGCACCCCAGCTCAACCCAATTGATGGA CCACTACCTGAGGATAATGAGCC

451 GAGCCCAGGA GGTGGAGGCT GCAGTGAGCC ACTGCACCCC AGCCKRGGTG

 

501 ACAGAGYGAG ACCCTGTCCC AAAAGAATCC ACTATCTATC TTCAGAGCAG

 

551 GGCCAGGTGA GAGGAAAGAT


Chromatogram Explorer- Automatically exploring, converting and trimming chromatograms
Chromatogram Explorer is a very easy to use tool that will list all chromatogram files (SCF, ABI, AB1, AB) in the current folder. You can view the chromatograms while browsing through folders using its integrated Windows Explorer. Chromatogram Explorer can also trim low quality bases at the ends of your samples with a single push of a button! Now you can process/sort/search chromatograms in seconds.
How to use it
Start Chromatogram Explorer, and locate the folder that contains your chromatogram files. All chromatogram files (ABI/SCF) will be shown in the right panel. Low quality ends (that will be trimmed) are shown in dark red. Press 'Save' and your file will be saved as SCF of FASTA (you can choose the output format), while the low quality bases at the ends will be trimmed. Chromatogram Explorer is so small that you can put it on a floppy disk of Flash stick and taken it with you.


ABI to FASTA converter
This free tool will batch convert all (selected) ABI files to FASTA files. All you need to do is to locate your ABI chromatogram files and press the CONVERT button. It offers a great relief for the biologists who must convert hundreds of ABI chromatogram files manually. With our automatic ABI to FASTA converter you can convert hundreds or thousands of ABI chromatogram files in seconds. All with A SINGLE PUSH OF A BUTTON! Install process: You do not need to install it or unpack it. Just download the program and double click to run it. ABI to FASTA converter does not need additional software, updates, DLL's or Java to run. To uninstall it, just delete the program.


FASTA to multi-FASTA converter
This freeware tool will look for all FASTA files in the specified folder and will merge their content in a single file, generating a standard or custom Multi-FASTA file. The size of the program is only 0.7MB. No Java or additional modules are required to be installed.


Multi-FASTA to FASTA converter
This freeware program will split a multi-FASTA file in multiple standard FASTA files. The size of the program is only 0.6MB


DNA Baser [Free converter tool]
Easy to use software package providing batch DNA sequence assembly, contig editing, chromatogram viewer and rapid detection of mutations in DNA sequences. Files supported by DNA Baser are any type of ABI (ABI, AB, AB1), SCF, FASTA, SEQ. It has a fast assembly engine with a range of features that greatly speeds the process of sequence assembly and mutation analysis. DNA Baser is the only software which allow batch assembly (it automatically scan a folder for samples that belongs to the same contig, based on a name pattern, and assemble those samples without users intervention). It can also 'assemble to reference'. The program is fully functional for 60 days but the format conversion module is working even after the 60 days threshold.
The size of the program is 2MB.


SFF to Fasta converter

454 SFF Tools is an easy to use SFF file viewer/editor.

Features:

  • Displays SFF file size
  • Displays the number of samples/reads
  • Displays the average quality of each sample (before and after end trimming)
  • Displays the sample lenght (before and after end trimming)
  • Delete samples
  • Save/convert the loaded SFF file to multiFASTA
  • Cut a SFF file in smaller pieces


ReadSeq
Sequence format converstion: converts input DNA/AA sequence to specified format. Input format is determined automatically.. Automatically detects input format and converts into FASTA, Stanford, Genbank, NBRF, EMBL, GCG, DNAStrider, Fitch, Phylip, raw, PIR, MSF or NEXUS sequence formats.


The Scriptome - Protocols for Manipulating Biological Data. The Scriptome is a set of easy to use tools that filter, format, and merge data in tabular or common biological formats, and you don't have to be a programmer to use them. Use single tools to take a quick look at data, or string tools together in a protocol to explore the data more deeply. Good for *nix, Mac or Windows users.


SeqVerter by GeneStudio, Inc. (free) Converts sequence between different formats (Windows 2000/XP). Reads the following input: ABI traces (*.abi and *.ab1), CLUSTAL, DCSE, DNASIS, DNAStar (LaserGene), DNAStrider (including binary), EMBL, FASTA, GDE, GenBank, IBI/Pustell, Macaw, MSF, Nexus/PAUP, PHYLIP Interleaved, PIR/NBRF, SCF 2.0 and SCF 3.0 traces, Swiss-Prot, and TreeCon. Writes the following output formats: CLUSTAL, DNASIS, DNAStar (LaserGene), FASTA, FASTA (Strict), and FASTA (SequIn), GenBank, IBI/Pustell, MSF, Nexus/PAUP, PHYLIP Interleaved, and TreeCon. Full export and import compatibility with Mac, PC, and UNIX text file formats.

ClustalW_Convert
Alignment format conversion between many formats. ClustalW_Convert converts from EMBL/Swiss-Prot, NBRF/PIR, FASTA (Pearson), Clustal (*.aln), GCG/MSF (pileup), GDE formats to GCG/MSF, ClustalW, NBRF/PIR, GDE and Phylip formats.


DPL Forum: Too few categories!

ABI View
Reads ABI file and display the trace (EMBOSS) and converts trace files into fasta format. ABIView is primarily a sequencing trace viewing program which also converts ABI (commonly suffixed *.abi and *.ab1) sequence trace files derived from automatic dna sequencing into FASTA (Pearson) format.

Advertisement | Your ad here

Around Wikia's network

Random Wiki