Wikia

MyBio

Sequence format conversion

804pages on
this wiki
Talk0

GGATCCAGCTCCGACGCAGCCGGCTGGCGAAGCGGCTGTCGAAGCCCGCCAGTTGTTTTCAGACACCGCAAACGACCTGGAAAACGGGGTGTCCAGCAACTGCCCCAAAGTCATCTTCATCTGCGCCCGCGGCTCCACCGAGACCGGCAACTTGGGCTCATCCGTCTGCCCCGAGGTAGCCAACGGCCTCAAGAACTACTACCCCAACCAACTCTGGGTGCAGGGCGTCGGGGGCGCCTACACGGCCGACCTGGCCTCCAACGCGCTTCCCGGGGGCACCTCGACGGCGGCGATGCAGGAGGCGGCCAACATGTTCAACCTGGCGCAGCAGAAGTGCCCGAACGCGTCGGTCGCCGCGGGCGGGTACAGCCAGGGCACGGCCGTCGTCGCCGGCGGCATCCAGTCGCTGTCGGCGGCGGCCAAGGACCAGATCAAGGGCGTCGTGCTCTTCGGCTACACGCAGGCGCAGCAGAACCACGACACCATCCCGGATTTCCCCGTCGACAAGACCATGATCTTCTGCGCCCAGGGCGACCTCGTCTGCAACGGCACCCTGATCGTCACCGCGGCCCACTTCTCCTACATCACCAACGGCGACGCGTCCACCAAGGGCCCGGCCTGGCTGCACGAGAAGATTGGCGATGCTTGAAAGCTTEdit

Around Wikia's network

Random Wiki